Ribosomes and Protein Synthesis

Free Response

Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'

Hint:

The mRNA would be: 5'-AUGGCCGGUUAUUAAGCA-3'. The protein would be: MAGY. Even though there are six codons, the fifth codon corresponds to a stop, so the sixth codon would not be translated.

Explain how single nucleotide changes can have vastly different effects on protein function.

Hint:

Nucleotide changes in the third position of codons may not change the amino acid and would have no effect on the protein. Other nucleotide changes that change important amino acids or create or delete start or stop codons would have severe effects on the amino acid sequence of the protein.

A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)

Hint:

Original mRNA: 5’ –UGCC AUG GUA AUA ACA CAU GAG GCC UGA AC– 3’;

Translation: Met – Val – Ile – Thr – His – Glu – Ala;

Mutated mRNA: 5’ –UGCC AUG GUU AAU AAC ACA UGA GGCCUGAAC– 3’;

Translation: Met – Val – Asn – Asn – Thr;

Insertion mutations can have dramatic effects on proteins because they shift the reading frame for the codons. This changes the amino acids encoded by the mRNA, and can introduce premature start or stop sites.